case study based questions grade 12 biology

CBSE Expert

CBSE Class 12 Biology Case Study Questions PDF Download

Welcome to the comprehensive guide on CBSE Class 12 Biology Case Study Questions! In this article, we will delve into the world of Biology case studies, explore the importance of case study questions, and provide you with a PDF download that will assist you in mastering this subject. Whether you’re a student preparing for your examinations or a teacher looking to enhance your teaching materials, our detailed resource will help you excel in the realm of Biology.

Case studies are a widely used educational tool that involves the in-depth analysis of a particular situation, organism, process, or problem. In CBSE Class 12 Biology, case study questions are designed to evaluate students’ critical thinking, problem-solving abilities, and practical application of biological concepts. These questions require students to apply their theoretical knowledge to real-life scenarios, thus fostering a deeper understanding of the subject matter.

Class 12 Biology Case Study Questions

CBSE Class 12 Biology question paper will have case study questions too. These case-based questions will be objective type in nature. So, Class 12 Biology students must prepare themselves for such questions. First of all, you should study NCERT Textbooks line by line, and then you should practice as many questions as possible.

Chapter-wise Solved Case Study Questions for Class 12 Biology

Class 12 students should go through important Case Study problems for Biology before the exams. This will help them to understand the type of Case Study questions that can be asked in Grade 12 Biology examinations. Our expert faculty for standard 12 Biology have designed these questions based on the trend of questions that have been asked in last year’s exams. The solutions have been designed in a manner to help the grade 12 students understand the concepts and also easy-to-learn solutions.

Books for Class 12 Biology

Strictly as per the new term-wise syllabus for Board Examinations to be held in the academic session 2022-23 for class 12 Multiple Choice Questions based on new typologies introduced by the board- Stand-Alone MCQs, MCQs based on Assertion-Reason Case-based MCQs. Include Questions from CBSE official Question Bank released in April 2022 Answer key with Explanations What are the updates in the book: Strictly as per the Term wise syllabus for Board Examinations to be held in the academic session 2022-23. Chapter-wise -Topic-wise Multiple choice questions based on the special scheme of assessment for Board Examination for Class 12th.

Tips to Excel in CBSE Class 12 Biology Case Study Questions

Thoroughly grasp the concepts.

Before attempting case study questions, ensure you have a strong grasp of fundamental biological concepts. Familiarize yourself with topics such as genetics, ecology, human physiology, and evolution. A solid foundation will empower you to tackle complex case studies with confidence.

Practice Regularly

Practice makes perfect, and this is especially true for case study questions. Allocate time to work through a diverse range of case studies regularly. Familiarizing yourself with different scenarios will prepare you for the unpredictability of examination questions.

Collaborate and Discuss

Engaging in group discussions with fellow students or teachers can be highly beneficial. Sharing perspectives, analyzing cases together, and discussing possible solutions can broaden your understanding and offer fresh insights.

Seek Guidance from Teachers

Don’t hesitate to approach your teachers for assistance. They possess valuable experience and expertise to guide you through challenging case studies and provide valuable feedback.

Time Management

During examinations, time management is crucial. Practice solving case study questions under timed conditions to improve your efficiency and ensure you complete all questions within the allocated timeframe.

In conclusion, mastering case study questions in CBSE Class 12 Biology is essential for a holistic understanding of the subject and for excelling in examinations. By honing your analytical abilities, practicing regularly, and seeking guidance, you can conquer even the most challenging case studies. Remember that learning Biology is not just about memorizing facts but about applying knowledge to real-world situations. So, embrace the power of case studies and delve into the fascinating world of Biology.

With the provided CBSE Class 12 Biology Case Study Questions PDF, you have a valuable resource at your disposal. Practice diligently, and you’ll witness your confidence soar as you become a proficient problem solver in the realm of Biology. Good luck on your academic journey!

Leave a Comment Cancel reply

Save my name, email, and website in this browser for the next time I comment.

Download India's best Exam Preparation App Now.

Key Features

• Revision Notes
• Important Questions
• Previous Years Questions
• Case-Based Questions
• Assertion and Reason Questions

No thanks, I’m not interested!

• Bihar Board

HSC Result 2024

Cfa institute, srm university.

• RBSE 10th Result 2024
• RBSE 12th Result 2024
• Maharashtra HSC Result
• MBSE Result 2024
• TBSE Result 2024
• CBSE Board Result 2024
• Shiv Khera Special
• Education News
• Web Stories
• Current Affairs
• नए भारत का नया उत्तर प्रदेश
• School & Boards
• College Admission
• Govt Jobs Alert & Prep
• GK & Aptitude

Case Study Based Questions for CBSE Class 12 Biology Board Exam 2024: Read this article for Last Minute Revision

Cbse class 12 biology important case study questions : practise important case study based questions for class 12 biology board exam. these case study based questions are important for the upcoming cbse class 12 biology board exam 2024 on march 19, 2024..

CBSE Class 12th Biology Board Exam 2023-24 Pattern

The paper will be of 70 marks and the time duration for completing the paper will be 3 hours.

The paper will have 33 questions divided into 5 sections.

Section–A 16 questions of 1 mark each,

Section–B 5 questions of 2 marks each;

Section–C 7 questions of 3 marks each;

Section–D 2 case-based questions of 4 marks each,

and Section–E 3 questions of 5 marks each.

CBSE Class 12 Biology Important Case Study Based Questions

Case Study 1:  Nondisjunction is the failure of homologous chromosomes to disjoin correctly during meiosis. It leads to the formation of a new cell with an abnormal amount of genetic material. A number of clinical conditions are the result of this type of chromosomal mutation. This results in the production of gametes containing a greater or lesser chromosomal amount than normal ones. Consequently, the individual may develop a trisomy or monosomal syndrome. Nondisjunction can occur in both Meiosis I and Meiosis II of the cellular division. It is also the main cause of many genetic disorders; however, its origin and process remain vague. Although it results in the majority of cases from errors in maternal meiosis II, both paternal and maternal meiosis I do influence it. Maternal age is considered a risk factor for trisomy, as well as recombination alterations and many others that can affect chromosomal segregation.

• It is the presence of an extra chromosome in a diploid cell.
• An aneuploid cell differs from other cells only in size.
• It can be less number of chromosomes in a diploid cell.
• Aneuploidy always affects female individuals.
• both i and iii
• both ii and iii
• i, iii and iv
• Errors in meiosis I is the only cause of aneuploidy
• Aneuploidy always affects sex chromosomes.
• Most of the aneuploidy results from errors in cell division involved in egg formation.
• Nondisjunction in meiosis I can lead to more abnormal cells than disjunction in meiosis II.
• both I and iii
• both iii and iv
• I, iii and iv
• Aneuploidy is not influenced by the mother’s age.
• Delivery before 30 years of age can decrease the incidence of aneuploidy in most cases
• The chance of aneuploidy increases up to 22 years of age.
• There is a dramatic increase in aneuploidy if the maternal age exceeds 30

• both ii and iv
• Chromosomal disorders
• Mendelian disorders
• Incomplete dominance
• All the above

Q5: Assertion: All types of genetic disorders are caused by chromosomal nondisjunction.

• Both assertion and reason are correct and the reason is the correct explanation of assertion
• Both assertion and reason are correct but the reason is not the correct explanation of the assertion
• Assertion is correct but the reason is incorrect
• Both assertion and reason are incorrect

Case Study 2:  A Representative Diagram of the Human Genome Project:

• Biotechnology
• Biomonitoring
• Bioinformatics
• Biosystematics

Q2:  Name a free living, non-pathogenic nematode, the DNA of which has been completely sequenced.

Answer: Caenorhabditis elegans

Q3: Summarize the methodology adopted in the Human Genome Project.

Answer: Expressed Sequence Tags (ESTs) : The approach focused on identifying all the genes that are expressed as RNA.

Sequence Annotation : The other took the blind approach of simply sequencing the whole set of genome that contained all the coding and non-coding sequence, and later assigning different regions in the sequence with functions.

Q4: What are SNPs’? How are they useful in human genomics?

• Identify disease-causing genes in humans
• Can be used to understand the molecular mechanisms of sequence evolution.

Q5: Mention at least four salient features of the Human Genome Project.

• Human genome contains 3164.7 million bp.
• Average gene consists of 3000 bases, but sizes vary greatly.
• Almost all (99.9 percent) nucleotide bases are exactly the same in all people.
• Less than 2 percent of the genome codes for proteins.

Case Study 3: Two blood samples of suspects ‘A’ and ‘B’ were sent to the Forensic Department along with sample ‘C’ from the crime scene. The Forensic Department was assigned the responsibility of running the samples and matching the samples of the suspects with that of the sample from the scene of the crime and thereby identifying the culprit.

• A radioactively labelled double stranded RNA molecule.
• A radioactively labelled double stranded DNA molecule.
• A radioactively labelled single stranded DNA molecule.
• A radioactively labelled single stranded RNA molecule.

Q3: What does ‘minisatellite’ and ‘microsatellite’ mean in relation to DNA Fingerprinting?

Answer:  Minisatellite: the repeating unit consists of 10-100 base pairs.

Microsatellite: the repeating unit consists of 2-6 base pairs.

Q3: How does polymorphism arise in a population?

Answer: Polymorphism (variation at the genetic level) arises due to mutations.

Q4: State the steps involved in DNA Fingerprinting in a sequential manner.

• DNA isolation
• DNA digestion with restriction enzymes.
• DNA fragment separation by electrophoresis.
• Hybridization
• DNA visualization under UV light.

Case Study 4: Bacteria like Streptococcus pneumoniae  and Haemophilus influenzae  are responsible for the disease pneumonia in humans which infects the alveoli (air-filled sacs) of the lungs. As a result of the infection, the alveoli get filled with fluid leading to severe problems in respiration. The symptoms of pneumonia include fever, chills, cough, and headache. In severe cases, the lips and fingernails may turn gray to bluish in colour. A healthy person acquires the infection by inhaling the droplets/aerosols released by an infected person or even by sharing glasses and utensils with an infected person. Dysentery, plague, diphtheria, etc., are some of the other bacterial diseases in man. Many viruses also cause diseases in human beings. Rhinoviruses represent one such group of viruses that cause one of the most infectious human ailments – the common cold. They infect the nose and respiratory passage but not the lungs.

The common cold is characterized by nasal congestion and discharge, sore throat, hoarseness, cough,

headache, tiredness, etc., which usually lasts for 3-7 days. Droplets resulting from the cough or sneezes of an infected person are either inhaled directly or transmitted through contaminated objects such as pens, books, cups, doorknobs, computer keyboards or mice, etc., and cause infection in a healthy person.

• By exhaling droplets of a non-infected person.
• By headache or leg pain.
• By eating fast food.
• By inhaling droplets of an infected person.

Q4:  How long does the common cold last?

Answer: 3-7 days

Q5:  Write any two symptoms of the common cold and pneumonia.

Answer: Cough and nasal congestion.

Case Study 5: When you insert a piece of alien DNA into a cloning vector and transfer it into a bacterial, plant, or animal cell, the alien DNA gets multiplied. In almost all recombinant technologies, the ultimate aim is to produce a desirable protein. Hence, there is a need for the recombinant DNA to be expressed. The foreign gene gets expressed under appropriate conditions. The expression of foreign genes in host cells involves understanding many technical details. After having cloned the gene of interest and having optimised the conditions to induce the expression of the target protein, one has to consider producing it on a large scale. Can you think of any reason why there is a need for large-scale production? If any protein encoding gene is expressed in a heterologous host, it is called a recombinant protein. The cells harbouring cloned genes of interest may be grown on a small scale in the laboratory. The cultures may be used for extracting the desired protein and then purifying it by using different separation techniques.

• A continuous culture system
• A stirred-tank bioreactor without in-lets and out-lets
• Laboratory flask of the largest capacity
• None of the above
• upstream processing
• downstream processing
• bioprocessing
• postproduction processing
• Human insulin
• Growth hormone
• cleaving and joining of DNA segments with endonuclease
• cleaving DNA segments with endonuclease and re-joining with ligase
• cleaving and re-joining DNA segments with ligase
• cleaving DNA segments with ligase and re-joining with endonuclease

Case Study 6: Gene Therapy

Read the following and answer the questions that follow:

• Replacing a disease-causing gene with a healthy copy of the gene
• Inactivating a disease-causing gene that is not functioning properly
• Introducing a new or modified gene into the body to help treat a disease
• Adenosine deaminase
• phenylketonuria
• Phenylalanine
• Bone marrow transplantation
• Southern blotting

Q4 Introduction of gene isolate from bone marrow producing ADA should be introduced at what age to

• acute diseases
• physiological diseases
• hereditary diseases
• infectious diseases
• CBSE Class 12 Biology Previous Year Question Papers with Solutions PDF Download
• CBSE Class 12 Syllabus 2023-24 PDF (All Subjects)
• CBSE Class 12 Deleted Syllabus (All Subjects)
• CBSE Class 12 Previous Year Papers with Solution PDF Download
• CBSE Class 12 Additional Practice Questions
• CBSE Class 12 Sample Paper 2023-24 with Solution and Additional Practice Questions
• Important MCQs for CBSE Class 12 Biology, All Chapters
• CBSE Class 12 Biology Mind Maps for Quick Revision
• CBSE Class 12 NCERT Biology Revised Textbook PDF
• CBSE Class 12 NCERT Biology Solutions
• CBSE Class 12 Biology Chapter-wise notes
• CBSE Class 12 Date Sheet 2024
• CBSE Competency Based Questions 2023-24
• CBSE Class 12 Additional Practice Questions 2024

Get here latest School , CBSE and Govt Jobs notification in English and Hindi for Sarkari Naukari and Sarkari Result . Download the Jagran Josh Sarkari Naukri App . Check  Board Result 2024  for Class 10 and Class 12 like  CBSE Board Result ,  UP Board Result ,  Bihar Board Result ,  MP Board Result ,  Rajasthan Board Result  and Other States Boards.

• CBSE Board exam 2023 result date. + As per the guidelines released by the Central Board of Secondary Education (CBSE), the tentative dates for the CBSE Board Exam 2023 results are; for class 10th: 15th April 2023 and for class 12th: 30th April 2023.
• When is the Class 12th Biology CBSE Board exam? + According to the date sheet released by the Central Board of Secondary Education (CBSE) for class 12th, the Biology exam is scheduled for the 16th of March 2023. The day will be Thursday.
• OAVS Admit Card 2024
• MPPSC VAS Interview Call Letter 2024
• Bihar DElEd Answer Key 2024
• mahresult.nic.in 12th Result 2024
• 12th Result 2024 Maharashtra Board
• Maharashtra Board 12th Result 2024 Roll Number
• hscresult.mkcl.org Result 2024
• MBSE Result 2024 Class 12
• Mizoram HSSLC Toppers List 2024
• Bihar Deled Answer Key 2024
• CBSE Class 10

Latest Education News

(Updated) SRH vs RR Head to Head in IPL: Check Stats, Records and Results

Purple Cap in IPL 2024: Top Players List with Most Wickets in TATA IPL

Orange Cap in IPL 2024: Top Players List with Most Runs in TATA IPL

[Current] Orange Cap and Purple Cap Holders in IPL 2024

Who Won Yesterday IPL Match: RCB vs RR, Eliminator, Check All Details and Latest Points Table

India T20 World Cup 2024 Squad: ये है रोहित की ‘विराट’ टीम, किस रोल में कौन? देखें यहां

IPL Points Table 2024: आईपीएल 2024 Updated पॉइंट टेबल यहां देखें, KKR और RR, SRH, RCB Qualify

ICC T20 World Cup 2024: T20 वर्ल्ड कप का शेड्यूल जारी, कब और किससे है India का Match देखें यहां

IPL 2024 Qualifier 2: हैदराबाद के सामने रॉयल चैलेंज, कब, कहां और कैसे देखें क्वालीफायर 2, Tickets और Live Streaming डिटेल्स भी देखें

IPL 2024 Full Schedule: आईपीएल 2024 का फुल शेड्यूल, KKR पहुंचा फाइनल में   

DL New Rules 2024: RTO गए बिना ड्राइविंग टेस्ट कैसे करें पास? जानें यहां

Buddha Purnima 2024: 45+ Images, Quotes, Wishes, Messages to Share on WhatsApp, Facebook, Instagram Status and Stories

30+ Question of the Day for School Assembly with Answers (May 23, 2024)

Top 5 Word of the Day for Morning Assembly 23 May, 2024

School Assembly News Headlines, May 23: Pune Car Accident, World Para Athletics Championship, Heatwave, Singapore Flight and More Top News

Manipur 10th Result 2024: BSEM Class 10 Results Date and Time Soon at manresult.nic.in, Check Latest Updates Here

Can You Find The Odd Donut Piece Hidden This Dessert Box Within 3 Seconds? Try Your Luck!

Maharashtra HSC Toppers List 2024: MSBSHSE Class 12th Science, Commerce and Arts Toppers Name, Marks, District-wise Pass Percentage and Other Stats

Gujarat High Court Recruitment 2024 for 1318 Steno, Computer Operator and Other Posts

IPL 2024 Eliminator: RR vs RCB Team Squad, Match Time Today, Live Streaming and Expected Playing 11

myCBSEguide

• Class 12 Biology Case...

Class 12 Biology Case Study Questions

Table of Contents

myCBSEguide App

Download the app to get CBSE Sample Papers 2023-24, NCERT Solutions (Revised), Most Important Questions, Previous Year Question Bank, Mock Tests, and Detailed Notes.

As we know that CBSE will now ask case study questions in each subject. In most of the cases, we have noticed that these case-based questions are high-scoring. A little effort on these case study questions can help you get good marks in your board exams. You can download CBSE Class 12 Biology Case Study Questions from the myCBSEguide App or from our Student Dashboard .

Let’s understand what type of case study questions CBSE asks in class 12 Biology. If you analyze the latest class 12 Biology sample papers , you will find that there are two types of case study questions in the Biology question papers.

• Case Studies with objective questions
• Case studies with subjective questions

As per the latest circular issued by CBSE on Assessment and Evaluation Practices of the Board for the Session 2022-23 , CBSE has clearly mentioned that competency-based questions including case studies will be different from subjective questions. Hence, we expect that CBSE will ask only objective questions in CBSE class 12 Biology case study questions too.

Biology Competency Based Questions

As discussed earlier too, the competency-based questions promote learning development for our students and test higher-order skills, such as analysis, critical thinking and conceptual clarity. Case study questions are actually competency-based questions. The very purpose of including such questions in the curriculum is to emphasise on development of problem-solving ability and the ability to apply knowledge in real-life situations.

Even in CBSE Class 12 Biology case studies, you will find some text input like paragraphs, pictures, data etc followed by some objective-type questions. You should read the given information carefully and then answer the questions.

CBSE 12th Biology Case Study MCQs

Here is one example question on subjective type case study questions. This was given in the term-2 sample paper in 2022.

Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single-stranded DNA. BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand.

• What is the objective of this action?
• Explain how the gene of interest is introduced into a vector.
• You are given the DNA shown below. 5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’ If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.
• A gene M was introduced into E.coli cloning vector PBR322 at the BamH1 site. What will be its impact on the recombinant plasmids? Give a possible way by which you could differentiate non-recombinant to recombinant plasmids.

Let’s take another example from MCQ type question:

To answer the questions, study the graphs below for Subject-1 and 2 showing different levels of certain hormones.

The peak observed in Subject-1 and 2 is due to

• progesterone
• luteinizing hormone
• follicle stimulating hormone

Subject 2 has higher level of hormone B, which is

If the peak of Hormone A does not appear in the study for Subject 1, which of the following statement is true?

• Peak of Hormone B will be observed at a higher point in the graph
• Peak of Hormone B will be observed at a point lower than what is given in the graph
• There will be no observed data for Hormone B
• The graph for Hormone B will be a sharp rise followed by a plateau

Which structure in the ovary will remain functional in subject 2?

• Corpus Luteum
• Tertiary follicle
• Graafian follicle
• Primary follicle

For subject 2 it is observed that the peak for hormone B has reached the plateau stage. After approximately how much time will the curve for hormone B descend?

Which of the following statements is true about the subjects?

• Subject 1 is pregnant
• Subject 2 is pregnant
• Both subject 1 and 2 are pregnant
• Both subject 1 and 2 are not pregnant

Another example of a class 12 Biology case study question

We use microbes or products which are derived from them every day. A common example is the production of curd from milk. Micro-organisms such as Lactobacillus and others commonly called lactic acid bacteria (LAB) grow in milk and convert it to curd. The dough, which is used for making foods such as dosa and idli is also fermented by bacteria. A number of traditional drinks and foods are also made by fermentation by microbes.  ‘Toddy’, a traditional drink in some parts of southern India is made by fermenting sap from palms. The ‘Roquefort cheese’ is ripened by growing specific fungi on them, which gives them a particular flavour. Different varieties of cheese are known by their characteristic texture, flavour and taste, the specificity coming from the microbes used.

• Penicillium notatum
• Saccharomyces cerevisiae
• Aspergillus niger
• Clostridium butylicum
• thermal vents
• polluted water
• all of these
• None of the above
• production of a large amount of CO 2
• production of O 2
• due to the presence of water
• none of these
• Both Assertion and Reason are true and Reason is the correct explanation of the Assertion
• Both Assertion and Reason are true but Reason is not the correct explanation of the Assertion
• Our Assertion is true but the Reason is false
• Both the statements are false

Download 12 Biology Case Study Questions

In this article, we have given you a few examples of class 12 Biology case study questions. We advise you to download the myCBSEguide App or access our Student Dashboard to get more case study questions for CBSE class 12 biology. We have hundreds of questions on case studies related to CBSE Class 12 Biology. As CBSE is now focusing more on the understanding of the concepts, it is a must for students to practice such questions regularly.

Test Generator

Create question paper PDF and online tests with your own name & logo in minutes.

Question Bank, Mock Tests, Exam Papers, NCERT Solutions, Sample Papers, Notes

Related Posts

• Competency Based Learning in CBSE Schools
• Class 11 Physical Education Case Study Questions
• Class 11 Sociology Case Study Questions
• Class 12 Applied Mathematics Case Study Questions
• Class 11 Applied Mathematics Case Study Questions
• Class 11 Mathematics Case Study Questions
• Class 11 Biology Case Study Questions
• Class 12 Physical Education Case Study Questions

Leave a Comment

Save my name, email, and website in this browser for the next time I comment.

• Andhra Pradesh
• Chhattisgarh
• West Bengal
• Madhya Pradesh
• Maharashtra
• Jammu & Kashmir
• NCERT Books 2022-23
• NCERT Solutions
• NCERT Notes
• NCERT Exemplar Books
• NCERT Exemplar Solution
• States UT Book
• School Kits & Lab Manual
• NCERT Books 2021-22
• NCERT Books 2020-21
• NCERT Book 2019-2020
• NCERT Book 2015-2016
• RD Sharma Solution
• TS Grewal Solution
• TR Jain Solution
• Selina Solution
• Frank Solution
• ML Aggarwal Solution
• Lakhmir Singh and Manjit Kaur Solution
• I.E.Irodov solutions
• ICSE - Goyal Brothers Park
• ICSE - Dorothy M. Noronhe
• Sandeep Garg Textbook Solution
• Micheal Vaz Solution
• S.S. Krotov Solution
• Evergreen Science
• KC Sinha Solution
• ICSE - ISC Jayanti Sengupta, Oxford
• ICSE Focus on History
• ICSE GeoGraphy Voyage
• ICSE Hindi Solution
• ICSE Treasure Trove Solution
• Thomas & Finney Solution
• SL Loney Solution
• SB Mathur Solution
• P Bahadur Solution
• Narendra Awasthi Solution
• MS Chauhan Solution
• LA Sena Solution
• Integral Calculus Amit Agarwal Solution
• IA Maron Solution
• Hall & Knight Solution
• Errorless Solution
• Pradeep's KL Gogia Solution
• OP Tandon Solutions
• Sample Papers
• Previous Year Question Paper
• Value Based Questions
• CBSE Syllabus
• CBSE MCQs PDF
• Assertion & Reason
• New Revision Notes
• Revision Notes
• HOTS Question
• Marks Wise Question
• Toppers Answer Sheets
• Exam Paper Aalysis
• Concept Map
• CBSE Text Book
• Additional Practice Questions
• Vocational Book
• CBSE - Concept
• KVS NCERT CBSE Worksheets
• Formula Class Wise
• Formula Chapter Wise
• JEE Crash Course
• JEE Previous Year Paper
• Important Info
• JEE Mock Test
• JEE Sample Papers
• SRM-JEEE Mock Test
• VITEEE Mock Test
• BITSAT Mock Test
• Manipal Engineering Mock Test
• AP EAMCET Previous Year Paper
• COMEDK Previous Year Paper
• GUJCET Previous Year Paper
• KCET Previous Year Paper
• KEAM Previous Year Paper
• Manipal Previous Year Paper
• MHT CET Previous Year Paper
• WBJEE Previous Year Paper
• AMU Previous Year Paper
• TS EAMCET Previous Year Paper
• SRM-JEEE Previous Year Paper
• VITEEE Previous Year Paper
• BITSAT Previous Year Paper
• UPSEE Previous Year Paper
• CGPET Previous Year Paper
• CUSAT Previous Year Paper
• AEEE Previous Year Paper
• Crash Course
• Previous Year Paper
• NCERT Based Short Notes
• NCERT Based Tests
• NEET Sample Paper
• Previous Year Papers
• Quantitative Aptitude
• Numerical Aptitude Data Interpretation
• General Knowledge
• Mathematics
• Agriculture
• Accountancy
• Business Studies
• Political science
• Enviromental Studies
• Mass Media Communication
• Teaching Aptitude
• NAVODAYA VIDYALAYA
• SAINIK SCHOOL (AISSEE)
• Mechanical Engineering
• Electrical Engineering
• Electronics & Communication Engineering
• Civil Engineering
• Computer Science Engineering
• CBSE Board News
• Scholarship Olympiad
• School Admissions
• Entrance Exams
• All Board Updates
• Miscellaneous
• State Wise Books
• Engineering Exam

SHARING IS CARING If our Website helped you a little, then kindly spread our voice using Social Networks. Spread our word to your readers, friends, teachers, students & all those close ones who deserve to know what you know now.

CBSE Class 12th - BIOLOGY : Chapterwise Case Study Question & Solution

CBSE will ask two Case Study Questions in the CBSE class 12 Biology questions paper. Question numbers 15 and 16 are case-based questions where 5 MCQs will be asked based on a paragraph. Each theme will have five questions and students will have a choice to attempt any four of them.

• NCERT Solutions for Class 12 Maths
• NCERT Solutions for Class 10 Maths
• CBSE Syllabus 2023-24
• Social Media Channels
• Login Customize Your Notification Preferences
• CBSE Class 12 Marks Verification Window Last Date Today: Apply Soon, Direct Link Here 21 May, 2024, 11:16 am
• CBSE Class 12 Result 2024: Application for Verification of Marks Starts; Last Date 21st May – Check Complete Process 17 May, 2024, 12:35 pm
• CBSE Class 12 Result 2024 Latest Update : Verification of Marks, Revaluation & Photocopy of Answer Sheet; Check Complete Process 14 May, 2024, 12:04 pm
• CBSE Class 12th Result 2024 Out : Supplementary, Re-verification & Re-evaluation Date Released; Check Details Here 13 May, 2024, 3:40 pm
• CBSE 12th Toppers List 2024: Check Toppers Name, Marks, Pass Percentage, Merit List, District & Result Full Statistics 13 May, 2024, 12:15 pm
• CBSE 12th Results 2024 Out : CBSE 12th Result Declared; Check Scorecard Here from Direct Link 13 May, 2024, 11:40 am
• CBSE 12th 2024-25 : Biology Official Competency Focused Practice Questions released by CBSE 7 May, 2024, 4:29 pm
• CBSE 12th 2024-25 : Mathematics Official Competency Focused Practice Questions released by CBSE 7 May, 2024, 3:51 pm
• CBSE Board Class 12 Computer Science Answer Key 2024 and Question Papers, Download PDF All SETs 2 April, 2024, 1:51 pm

• Second click on the toggle icon

Provide prime members with unlimited access to all study materials in PDF format.

Allow prime members to attempt MCQ tests multiple times to enhance their learning and understanding.

Provide prime users with access to exclusive PDF study materials that are not available to regular users.

• Book Solutions
• State Boards

Case Study Questions Class 12 Biology Ecosystem

Case study questions class 12 biology chapter 14 ecosystem.

CBSE Class 12 Case Study Questions Biology Ecosystem. Term 2 Important Case Study Questions for Class 12 Board Exam Students. Here we have arranged some Important Case Base Questions for students who are searching for Paragraph Based Questions Ecosystem.

At Case Study Questions there will given a Paragraph. In where some Important Questions will made on that respective Case Based Study. There will various types of marks will given 1 marks, 2 marks, 3 marks, 4 marks.

CBSE Case Study Questions Class 12 Biology Ecosystem

Case study 1

Interaction of biotic and abiotic components result in a physical structure that is characteristic for each type of ecosystem. Identification and enumeration of plant and animal species of an ecosystem gives its species composition. Vertical distribution of different species occupying different levels is called stratification. For example, trees occupy top vertical strata or layer of a forest, shrubs the second and herbs and grasses occupy the bottom layers. The components of the ecosystem are seen to function as a unit when you consider the following aspects: (i) Productivity; (ii) Decomposition; (iii) Energy flow; and (iv) Nutrient cycling. To understand the ethos of an aquatic ecosystem let us take a small pond as an example. This is fairly a self-sustainable unit and rather simple example that explain even the complex interactions that exist in an aquatic ecosystem. A pond is a shallow water body in which all the above mentioned four basic components of an ecosystem are well exhibited. The abiotic component is the water with all the dissolved inorganic and organic substances and the rich soil deposit at the bottom of the pond. The solar input, the cycle of temperature, day-length and other climatic conditions regulate the rate of function of the entire pond. The autotrophic components include the phytoplankton, some algae and the floating, submerged and marginal plants found at the edges.

The consumers are represented by the zooplankton, the free swimming and bottom dwelling forms. The decomposers are the fungi, bacteria and flagellates especially abundant in the bottom of the pond. This system performs all the functions of any ecosystem and of the biosphere as a whole, i.e., conversion of inorganic into organic material with the help of the radiant energy of the sun by the autotrophs; consumption of the autotrophs by heterotrophs; decomposition and mineralisation of the dead matter to release them back for reuse by the autotrophs, these event are repeated over and over again. There is unidirectional movement of energy towards the higher trophic levels and its dissipation and loss as heat to the environment.

Que. 1) Autotrophs consumption in the ecosystem occurs by …………………………………………………………………………………… .

(a) Decomposers

(b) Autotrophs

(c) Heterotrophs

(d) Herbivores

Que. 2) …………………………………………………………………… are represented as a consumer.

(a) Zooplanktons

(c) Flagellated

Que. 3) Components of ecosystem include ………………………………………………………………………………… .

(a) Kreb cycle

(b) Glucose cycle

(c) Cell cycle

(d) Nutrient cycle

Que. 4) Write definition of ‘Stratification’ and give one example of it.

Que. 5) Which decomposers are important to function ecosystem?

Que. 1)(c) Heterotrophs.

Que. 2) (a) Zooplanktons.

Que. 3) (d) Nutrient cycle.

Que. 4) Answer: Different levels which are occupied by vertical distribution of different species, this is called as Stratification. In the forest, trees occupy top layer and grasses occupy bottom layer. This is an example of Stratification.

Que. 5) Answer: Decomposers such as flagellated, bacteria and fungi are import to function ecosystem.

Case study 2

A constant input of solar energy is the basic requirement for any ecosystem to function and sustain. Primary production is defined as the amount of biomass or organic matter produced per unit area over a time period by plants during photosynthesis. It is expressed in terms of weight (gm–2 ) or energy (kcal m–2 ). The rate of biomass production is called productivity. It is expressed in terms of gm–2 yr –1 or (kcal m–2) yr –1 to compare the productivity of different ecosystems. It can be divided into gross primary productivity (GPP) and net primary productivity (NPP). Gross primary productivity of an ecosystem is the rate of production of organic matter during photosynthesis. A considerable amount of GPP is utilised by plants in respiration. Gross primary productivity minus respiration losses (R), is the net primary productivity (NPP). GPP – R = NPP Net primary productivity is the available biomass for the consumption to heterotrophs (herbiviores and decomposers). Secondary productivity is defined as the rate of formation of new organic matter by consumers. Primary productivity depends on the plant species inhabiting a particular area. It also depends on a variety of environmental factors, availability of nutrients and photosynthetic capacity of plants. Therefore, it varies in different types of ecosystems. The annual net primary productivity of the whole biosphere is approximately 170 billion tons (dry weight) of organic matter. Of this, despite occupying about 70 per cent of the surface, the productivity of the oceans are only 55 billion tons. Rest of course, is on land.

Que. 1) In the ecosystem, the …………………………………………………………………………………. is expressed in terms of gm -2 yr -1 .

(a) Energy flow

(b) Productivity

(c) Decomposition

(d) Cycle of nutrients

Que. 2) Complete the following equation of Net primary productivity.

NPP= GPP ___   _______.

Que. 3) Productivity is defined as the rate of …………………………………………………………………………….. production.

(a) Net primary

(b) Biomass

(c) Inorganic matter

(d) All of them

Que. 4) Explain the factors on which primary productivity is dependent?

Que. 5) Define ‘Gross primary productivity’.

Que. 1)(b) Productivity

Que. 2) (d) –R.

Que. 3) (b) Biomass.

Que. 4) Answer: Availability of nutrients, environmental factors, plant species, and photosynthetic capacity of plants these are the factors on which primary productivity is dependent.

Que. 5) Answer: Gross primary productivity- During photosynthesis process, the rate of production of organic matter is called as GPP or Gross primary productivity.

Case study 3

You may have heard of the earthworm being referred to as the farmer’s ‘friend’. This is so because they help in the breakdown of complex organic matter as well as in loosening of the soil. Similarly, decomposers break down complex organic matter into inorganic substances like carbon dioxide, water and nutrients and the process is called decomposition. Dead plant remains such as leaves, bark, flowers and dead remains of animals, including fecal matter, constitute detritus, which is the raw material for decomposition. The important steps in the process of decomposition are fragmentation, leaching, catabolism, humification and mineralisation. Detritivores (e.g., earthworm) break down detritus into smaller particles. This process is called fragmentation. By the process of leaching, watersoluble inorganic nutrients go down into the soil horizon and get precipitated as unavailable salts. Bacterial and fungal enzymes degrade detritus into simpler inorganic substances. This process is called as catabolism. It is important to note that all the above steps in decomposition operate simultaneously on the detritus (Figure 14.1). Humification and mineralisation occur during decomposition in the soil. Humification leads to accumulation of a dark coloured amorphous substance called humus that is highly resistant to microbial action and undergoes decomposition at an extremely slow rate. Being colloidal in nature it serves as a reservoir of nutrients. The humus is further degraded by some microbes and release of inorganic nutrients occur by the process known as mineralisation. Decomposition is largely an oxygen-requiring process.

The rate of decomposition is controlled by chemical composition of detritus and climatic factors. In a particular climatic condition, decomposition rate is slower if detritus is rich in lignin and chitin, and quicker, if detritus is rich in nitrogen and water-soluble substances like sugars. Temperature and soil moisture are the most important climatic factors that regulate decomposition through their effects on the activities of soil microbes. Warm and moist environment favour decomposition whereas low temperature and anaerobiosis inhibit decomposition resulting in build-up of organic materials.

Que. 1) Which of the following is a raw material for decomposition?

(b) Dead Plant

(c) Flowers

(d) Animals

Que. 2) When water soluble inorganic nutrients goes down in the soil and precipitated as unavailable salts, then the process is called as ……………………………………………………………………………………… .

(a) Catabolism

(b) Fermentation

(c) Humification

(d) Leaching

Que. 3) ……………..……………………………………………………… is required in the decomposition process.

(b) Phosphorous

(d) Nitrogen

Que. 4) What is meant by catabolism?

Que. 5) Write a very short note on Mineralisation from above paragraph.

Que. 1)(b) Dead Plant.

Que. 2) (d) Leaching.

Que. 3) (a) Oxygen.

Que. 4) Answer: When the fungal and bacterial enzymes degrade detritus and convert it into simpler inorganic substance, then it is called as Catabolism.

Que. 5) Answer: In this process, some microbes degrade humus. The inorganic nutrients are released by the process and the process is known as Mineralisation. 

Case study 4

Except for the deep sea hydro-thermal ecosystem, sun is the only source of energy for all ecosystems on Earth. Of the incident solar radiation less than 50 per cent of it is photosynthetically active radiation (PAR). We know that plants and photosynthetic bacteria (autotrophs), fix Sun’s radiant energy to make food from simple inorganic materials. Plants capture only 2-10 per cent of the PAR and this small amount of energy sustains the entire living world. So, it is very important to know how the solar energy captured by plants flows through different organisms of an ecosystem. All organisms are dependent for their food on producers, either directly or indirectly. The green plant in the ecosystem are called producers. In a terrestrial ecosystem, major producers are herbaceous and woody plants. Likewise, producers in an aquatic ecosystem are various species like phytoplankton, algae and higher plants. You have read about the food chains and webs that exist in nature. Starting from the plants (or producers) food chains or rather webs are formed such that an animal feeds on a plant or on another animal and in turn is food for another. The chain or web is formed because of this interdependency. No energy that is trapped into an organism remains in it for ever. The energy trapped by the producer, hence, is either passed on to a consumer or the organism dies. Death of organism is the beginning of the detritus food chain/web. All animals depend on plants (directly or indirectly) for their food needs.

They are hence called consumers and also heterotrophs. If they feed on the producers, the plants, they are called primary consumers, and if the animals eat other animals which in turn eat the plants (or their produce) they are called secondary consumers. Likewise, you could have tertiary consumers too. Obviously the primary consumers will be herbivores. Some common herbivores are insects, birds and mammals in terrestrial ecosystem and molluscs in aquatic ecosystem.

Que. 1) ………………………………………………………………………. Is an herbivore organism in the aquatic ecosystem.

(a) Molluscs

(b) Insects

(c) Mammals

Que. 2) In the ecosystem, green plants are ……………………………………………………………………………………… .

(a) Consumers

(b) Decomposers

(c) Producers

Que. 3) PAR is a …………………………………….……………………………… .

(a) Powerful Atomic Radiation.

(b) Photosynthetically Atomic Radiation.

(c) Photosynthetically Active Radiation.

(d) Powerful Active Radiation.

Que. 4) Which ecosystem on earth does not require sun as an energy source?

Que. 5) Name any two producers from aquatic ecosystem.

Que. 1)(a) Molluscs.

Que. 2) (c) Producers.

Que. 3) (c) Photosynthetically Active Radiation.

Que. 4) Answer: The deep sea hydro-thermal ecosystem is the ecosystem on earth that does not require sun as an energy source.

Que. 5) Answer: Algae and phytoplankton both are producers in an aquatic ecosystem.

Case study 5

The consumers that feed on these herbivores are carnivores, or more correctly primary carnivores (though secondary consumers). Those animals that depend on the primary carnivores for food are labelled secondary carnivores. A simple grazing food chain (GFC) is depicted below:

  The detritus food chain (DFC) begins with dead organic matter. It is made up of decomposers which are heterotrophic organisms, mainly fungi and bacteria. They meet their energy and nutrient requirements by degrading dead organic matter or detritus. These are also known as saprotrophs (sapro: to decompose). Decomposers secrete digestive enzymes that breakdown dead and waste materials into simple, inorganic materials, which are subsequently absorbed by them. In an aquatic ecosystem, GFC is the major conduit for energy flow. As against this, in a terrestrial ecosystem, a much larger fraction of energy flows through the detritus food chain than through the GFC. Detritus food chain may be connected with the grazing food chain at some levels: some of the organisms of DFC are prey to the GFC animals, and in a natural ecosystem, some animals like cockroaches, crows, etc., are omnivores. These natural interconnection of food chains make it a food web. How would you classify human beings!

Que. 1) ………………………………………………………………………….. is a beginning of Detritus food chain.

(a) Living organic matter

(b) Producers

(c) Dead organic matter

(d) Consumers

Que. 2) The meaning of sapro word in the saprotrophs is ………………………………………………………………………………………… .

(a) To produce

(b) To divide

(c) To consume

(d) To decompose

Que. 3) GFC is a ………………………………………………………………………. .

(a) Global food chain

(b) Grazing food chain

(c) Global food consumers

(d) Grazing form chain

Que. 4) Write a short note on Grazing food chain.

Que. 5) What is ‘Food web’.

Que. 1)(c) Dead organic matter.

Que. 2) (d) To decompose.

Que. 3) (b) Grazing food chain.

Que. 4) Answer: The producers are present in beginning of grazing food chain. Grass is taken as producer in this chain. Then goat is primary consumer because it eats or consume grass. Man are secondary consumers in the chain because man consume goat which consumes grass.

Que. 5) Answer: The normal interconnection of food chain is known as Food web.

Case study 6

An important characteristic of all communities is that their composition and structure constantly change in response to the changing environmental conditions. This change is orderly and sequential, parallel with the changes in the physical environment. These changes lead finally to a community that is in near equilibrium with the environment and that is called a climax community. The gradual and fairly predictable change in the species composition of a given area is called ecological succession. During succession some species colonise an area and their population become more numerous whereas populations of other species decline and even disappear. The entire sequence of communities that successively change in a given area are called sere(s). The individual transitional communities are termed seral stages or seral communities.

In the successive seral stages there is a change in the diversity of species of organisms, increase in the number of species and organisms as well as an increase in the total biomass. The present day communities in the world have come to be because of succession that has occurred over millions of years since life started on earth. Actually succession and evolution would have been parallel processes at that time.Examples of areas where primary succession occurs are newly cooled lava, bare rock, newly created pond or reservoir. The establishment of a new biotic community is generally slow. Before a biotic community of diverse organisms can become established, there must be soil. Depending mostly on the climate, it takes natural processes several hundred to several thousand years to produce fertile soil on bare rock.

Secondary succession begins in areas where natural biotic communities have been destroyed such as in abandoned farm lands, burned or cut forests, lands that have been flooded. Since some soil or sediment is present, succession is faster than primary succession.

Que. 1) A succeseful change of entire sequence of communities in a given area is known as …………………………………………………………………………………… .

(a) Ecological succession

(c) Ecology

(d) Community

Que. 2) In a given area, when species composition predictably changes then it is a ………………………………………………………………………………… .

(b) Climax community

(c) Climax changes

(d) Ecological succession

Que. 3) …………………………………………………………………… is the area where secondary succession begins.

(a) Cut forests

(b) Cooled lava

(c) New pond

(d) Bare rock

Que. 4) Give an example of area where primary succession occurs.

Que. 5) Where does secondary succession begins?

Que. 1)(b) Sere

Que. 2) (a) Cut forests.

Que. 3) (d) Ecological succession.

Que. 4) Answer: Primary succession mainly occurs in the area such as bare rock, newly created ponds and newly cooled lava.

Que. 5) Answer: The natural biotic communities were destroyed in an area. From that area secondary succession begins.

Leave a Reply Cancel reply

Your email address will not be published. Required fields are marked *

Save my name, email, and website in this browser for the next time I comment.

We have a strong team of experienced Teachers who are here to solve all your exam preparation doubts

Tripura board class 6 bengali solutions chapter 2 তালগাছ, 2025 solved icse specimen paper class 10 english paper 1, tripura board class 6 bengali solutions chapter 1 লব-কুশের রামায়ণ গান, sikkim scert class 5 evs chapter 8 smart buyers solution.

Sign in to your account

Username or Email Address

Remember Me

• New QB365-SLMS
• NEET Materials
• JEE Materials
• Banking first yr Materials
• TNPSC Materials
• DIPLOMA COURSE Materials
• 5th Standard Materials
• 12th Standard Materials
• 11th Standard Materials
• 10th Standard Materials
• 9th Standard Materials
• 8th Standard Materials
• 7th Standard Materials
• 6th Standard Materials
• 12th Standard CBSE Materials
• 11th Standard CBSE Materials
• 10th Standard CBSE Materials
• 9th Standard CBSE Materials
• 8th Standard CBSE Materials
• 7th Standard CBSE Materials
• 6th Standard CBSE Materials
• Tamilnadu Stateboard
• Scholarship Exams
• Scholarships

CBSE 12th Standard Biology Subject Human Reproduction Case Study Questions With Solution 2021

By QB365 on 21 May, 2021

QB365 Provides the updated CASE Study Questions for Class 12 Biology, and also provide the detail solution for each and every case study questions . Case study questions are latest updated question pattern from NCERT, QB365 will helps to get  more marks in Exams

QB365 - Question Bank Software

12th Standard CBSE

Final Semester - June 2015

Case Study Questions

(ii) Identify the correctly matched pair.

(iii) Which statement is incorrect for Q?

(iv) Which structure passes through the prostate gland and carries sperms and secretion of seminal vesicle?

(v ) Assertion: Mucus present in secretion of bulbourethral gland decreases the number of sperms damaged during ejaculation Reason: Mucus lubricates the end of penis and lining of the urethra. (a) Both assertion and reason are true and reason is the correct explanation of assertion. (b) Both assertion and reason are true but reason is not the correct explanation of assertion. (c) Assertion is true but reason is false. (d) Both assertion and reason are false .

Read the following and answer any four questions from (i) to (v) given below: The first menstruation is called menarche, that usually occurs between 12 and 15 years. In human females, menstruation is repeated at an average interval of about 28129 days and is called menstrual cycle. It is regulated by certain hormones, as pituitary gland is stimulated by releasing factors produced in the hypothalamus. The hormones produced by pituitary gland influence the ovaries. The hormones secreted by the ovaries affect the walls of the uterus. (i) The breakdown of endometrium is characteristic of

(ii) Which days of the menstrual cycle marks the proliferative phase?

(iii) Which of the following occurs during secretory phase?

(iv) Identify the hormones that attain peak level during ovulatory phase

(v) Withdrawal of which hormone causes degeneration of corpus luteum?

*****************************************

Cbse 12th standard biology subject human reproduction case study questions with solution 2021 answer keys.

A. Acrosome (i) The secretions.enzymes of acrosome dissolve the egg envelopes and help the sperm enter the cytoplasm of the ovum. B. Mitochondria (i) The mitochondria in the middle piece provide energy for the sperm motility in the female reproductive tract towards ovum. C. Tail (i) It facilitates the movement of sperm towards the ovum for fertilisation.

(a) X is hormone estrogen. (i) It is secreted by the cells of the developing follicle. Y is hormone progesterone. (ii) It is secreted by corpus luteum. (b) (i) X is secreted by the cells of the follicle during follicular phase before ovulation; after the rupture of Graafian follicle, there is no secretion of estrogen. (ii) Y is secreted by corpus luteum that is formed after ovulation in the luteal phase; hence X peaks before Y.

(i) 1. Gonadotropin-releasing hormone (GnRH) 2. Follicle-stimulating hormone (FSH) and Luteinising hormone (LH) 3. Progesterone. (b) Corpus luteum secretes progesterone.

(i) (b) : P is an epididymis that stores the sperms and secretes a fluid which is considered to nourish the sperms (ii) (b) : Q - Vas deferens, R - Ejaculatory duct S - Bulbourethral gland, T - Seminal vesicle (iii) (c) : Q (vas deferens) arises from cauda epididymis (iv) (d) (v) (a)

(i) (d): During menstrual phase, the endometrium breaks down and menstruation begins. (ii) (c) : Proliferative phase extends for about 10-12 days usually from day 6th to 13th in a 28 day cycle (iii) (a) (iv) (d) : During ovulatory phase, both LH and FSH attain a peak level (v) (b)

Related 12th Standard CBSE Biology Materials

12th standard cbse syllabus & materials, cbse 12th physics wave optics chapter case study question with answers, cbse 12th physics ray optics and optical instruments chapter case study question with answers, cbse 12th physics nuclei chapter case study question with answers, cbse 12th physics moving charges and magnetism chapter case study question with answers, cbse 12th physics electromagnetic induction chapter case study question with answers, cbse 12th physics atoms chapter case study question with answers, 12th physics alternating current chapter case study question with answers cbse, 12th maths vector algebra chapter case study question with answers cbse, 12th maths three dimensional geometry chapter case study question with answers cbse, 12th maths probability chapter case study question with answers cbse, 12th maths linear programming chapter case study question with answers cbse, 12th maths differential equations chapter case study question with answers cbse, 12th maths continuity and differentiability chapter case study question with answers cbse, 12th maths application of integrals chapter case study question with answers cbse, 12th chemistry the d and f block elements chapter case study question with answers cbse.

Class VI to XII

Tn state board / cbse, 3000+ q&a's per subject, score high marks.

12th Standard CBSE Study Materials

12th Standard CBSE Subjects

A .gov website belongs to an official government organization in the United States.

A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

• About Mild TBI and Concussion
• After a Mild TBI or Concussion
• Health Disparities in TBI
• Comparing Head Impacts
• Clinical Guidance
• Mild Traumatic Brain Injury Management Guideline
• Resources for Health Care Providers

Traumatic Brain Injury & Concussion

About Moderate and Severe TBI

Preventing TBI

Symptoms of Mild TBI and Concussion

Where to Get Help

Facts About TBI

For Medical Professionals

Clinical Guidance for Pediatric mTBI

Health Care Provider Resources

CDC Programs

HEADS UP Online Training Courses

National Concussion Surveillance System

Core State Injury Prevention Program (Core SIPP)

A traumatic brain injury, or TBI, is an injury that affects how the brain works. TBI is a major cause of death and disability in the United States.

For Everyone

Health care providers.

Gurukul of Excellence

Classes for Physics, Chemistry and Mathematics by IITians

Join our Telegram Channel for Free PDF Download

Case Study Questions for Class 12 Biology Chapter 13 Organisms and Populations

• Last modified on: 2 years ago
• Reading Time: 4 Minutes

Question 1:

Organism P has thick lips and tongue so that it can easily feed on the commonly available spiny plants. Organism Q has thick layer of insulating fat under the skin. It was strong hooves to walk steadily on steep surfaces and lives in burrows during winters. Organism R has bright colours and sticky pads on its fingers and toes. It lives on trees.

(i) Which of the following is correct habitat for organisms P regarding its adaptation? (a) Grassland biome (b) Desert biome (c) Tropical rainforest (d) Tropical deciduous forest

(ii) Which of the following is correct match regarding organism Q and its habitat? (a) Tundra – Polar bear (b) Tropical rain forest – Deer (c) Grassland – Bighorn sheep (d) Desert – Camel

(iii) Which of the following is incorrect regarding organisms R’s habitat? (a) The vegetation shows stratification (b) Epiphytic growth is rich (c) Standing crop is highest (d) Deep rooted shrubs are common due to abundant sunlight

(iv) The dominant plants in habitat where P lives could be (a) Opuntia (b) Nymphaea (c) Deodar (d) both (a) and (c).

(v) Organisms P, Q and R respectively most likely occur in

(a) F, B and A (b) C, A, E (c) A, F and C (d) B, D and A.

You may also like:

Case Study and Passage Based Questions for Class 12 Biology Chapter 2 Sexual Reproduction in Flowering Plants

Last modified on:2 years agoReading Time:4MinutesIn CBSE Class 12 Biology Paper, Students will have to answer some questions based on Assertion and Reason. There will be a few questions based on case studies and passage based as well. In that, a paragraph will be given, and then the MCQ questions based on it will be asked.…

Case Study and Passage Based Questions for Class 12 Biology Chapter 3 Human Reproduction

Last modified on:2 years agoReading Time:4MinutesIn CBSE Class 12 Biology Paper, Students will have to answer some questions based on Assertion and Reason. There will be a few questions based on case studies and passage based as well. In that, a paragraph will be given, and then the MCQ questions based on it will be asked. Here,…

Case Study Questions for Class 12 Biology Chapter 8 Human Health and Diseases

Last modified on:2 years agoReading Time:6MinutesCase Study Questions for Class 12 Biology Chapter 8 Human Health and Diseases Question 1: In a study to test a new vaccine against a viral disease, mouse model testing is done. In this process, mice are vaccinated and their blood samples were tested. Mice developed mild disease symptom. After few…

Case Study Questions for Class 12 Biology Chapter 10 Microbes in Human Welfare

Last modified on:2 years agoReading Time:3MinutesCase Study Questions for Class 12 Biology Chapter 10 Microbes in Human Welfare Question 1: Villagers in a place near Chambur started planning to make power supply for agricultural purposes from cow dung. They have started a biogas plant for the purpose. Study the flow chart for biogas production given below…

Case Study Questions for Class 12 Biology Chapter 11 Biotechnology – Principles and Techniques

Last modified on:2 years agoReading Time:4MinutesCase Study Questions for Class 12 Biology Chapter 11 Biotechnology – Principles and Techniques Question 1: The DNA, which is transferred from one organism into another by joining it with the vehicle DNA is called passenger or foreign DNA. Generally three types of passenger DNAs are used. These are complementary DNA…

Case Study Questions for Class 12 Biology Chapter 12 Biotechnology and Its Applications

Last modified on:2 years agoReading Time:5MinutesCase Study Questions for Class 12 Biology Chapter 12 Biotechnology and Its Applications Question 1: Transgenic cows have extra gene or genes inserted into their DNA. Firstly the genes for the desired product is identified and sequenced. Then a gene construct containing this desired gene is introduced into female cow cells.…

Last modified on:2 years agoReading Time:4MinutesCase Study Questions for Class 12 Biology Chapter 13 Organisms and Populations Question 1: Organism P has thick lips and tongue so that it can easily feed on the commonly available spiny plants. Organism Q has thick layer of insulating fat under the skin. It was strong hooves to walk steadily…

Case Study Questions for Class 12 Biology Chapter 15 Biodiversity and Conservation

Last modified on:2 years agoReading Time:4MinutesCase Study Questions for Class 12 Biology Chapter 15 Biodiversity and Conservation Question 1: Within a region, species richness increases with increasing explored area, but only upto a limit. The given graph explains this relationship. (i) What does the given figure show?(a) Rivet-popper hypothesis(b) Species-area relationship(c) Proportionate number of species of…

Case Study and Passage Based Questions for Class 12 Biology Chapter 1 Reproduction in Organisms

Last modified on:2 years agoReading Time:3MinutesCase Study/Passage Based Questions: Question 1: Given below is the diagram of a ginger rhizome. Answer the questions given below based onthe diagram. (i) Why do vegetative propagules in sugarcane and ginger appear from the nodes?(ii) Name the vegetative propagules in (a) Potato, and (b) Pistia.(iii) How does potato multiply? Answer…

Case Study and Passage Based Questions for Class 12 Biology Chapter 4 Reproductive Health

Last modified on:2 years agoReading Time:2MinutesCase Study and Passage Based Questions for Class 12 Biology Chapter 4 Reproductive Health Case Study/Passage Based Questions: Question 1: Study the diagram of the female reproductive system given below. Answer the questionsbased on the diagram. (i) What does the diagram depict?(ii) At what stage zygote can be introduced in the…

Download CBSE Books

Exam Special Series:

• Sample Question Paper for CBSE Class 10 Science (for 2024)
• Sample Question Paper for CBSE Class 10 Maths (for 2024)
• CBSE Most Repeated Questions for Class 10 Science Board Exams
• CBSE Important Diagram Based Questions Class 10 Physics Board Exams
• CBSE Important Numericals Class 10 Physics Board Exams
• CBSE Practical Based Questions for Class 10 Science Board Exams
• CBSE Important “Differentiate Between” Based Questions Class 10 Social Science
• Sample Question Papers for CBSE Class 12 Physics (for 2024)
• Sample Question Papers for CBSE Class 12 Chemistry (for 2024)
• Sample Question Papers for CBSE Class 12 Maths (for 2024)
• Sample Question Papers for CBSE Class 12 Biology (for 2024)
• CBSE Important Diagrams & Graphs Asked in Board Exams Class 12 Physics
• Master Organic Conversions CBSE Class 12 Chemistry Board Exams
• CBSE Important Numericals Class 12 Physics Board Exams
• CBSE Important Definitions Class 12 Physics Board Exams
• CBSE Important Laws & Principles Class 12 Physics Board Exams
• 10 Years CBSE Class 12 Chemistry Previous Year-Wise Solved Papers (2023-2024)
• 10 Years CBSE Class 12 Physics Previous Year-Wise Solved Papers (2023-2024)
• 10 Years CBSE Class 12 Maths Previous Year-Wise Solved Papers (2023-2024)
• 10 Years CBSE Class 12 Biology Previous Year-Wise Solved Papers (2023-2024)
• ICSE Important Numericals Class 10 Physics BOARD Exams (215 Numericals)
• ICSE Important Figure Based Questions Class 10 Physics BOARD Exams (230 Questions)
• ICSE Mole Concept and Stoichiometry Numericals Class 10 Chemistry (65 Numericals)
• ICSE Reasoning Based Questions Class 10 Chemistry BOARD Exams (150 Qs)
• ICSE Important Functions and Locations Based Questions Class 10 Biology
• ICSE Reasoning Based Questions Class 10 Biology BOARD Exams (100 Qs)

✨ Join our Online JEE Test Series for 499/- Only (Web + App) for 1 Year

✨ Join our Online NEET Test Series for 499/- Only for 1 Year

Leave a Reply Cancel reply

Join our Online Test Series for CBSE, ICSE, JEE, NEET and Other Exams

Editable Study Materials for Your Institute - CBSE, ICSE, State Boards (Maharashtra & Karnataka), JEE, NEET, FOUNDATION, OLYMPIADS, PPTs

Discover more from Gurukul of Excellence

Subscribe now to keep reading and get access to the full archive.

Type your email…

Continue reading